Leukotriene A4 hydrolase (LTA4H) (NM_000895) Human 3' UTR Clone

CAT#: SC201507

3' UTR clone of leukotriene A4 hydrolase (LTA4H) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Leukotriene A4 hydrolase (LTA4H) (NM_000895) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_000895
Insert Size 266 bp
Sequence Data
>SC201507 3’UTR clone of NM_000895
The sequence shown below is from the reference sequence of NM_000895. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGTGGGGAAAGACTTAAAAGTGGATTAAAGACCTGCGTATTGATGATTTTAGAGATTTCTCTTTTTT
AAATGGAATTCGTAAAGAAATATAAAACTTCAGCTCACAATTAAAACTGTCTTTTTAGTTTTGGCTTTT
TATTGTTTTGTTGGTGATTTTACTGAAATAAAGTTGAGCTACTTCTTCTTATAGTGGCATATTCTTTGT
AAATTTTAACAAGGTTTAATCTTTTGATTTACAAATTAAAAAATTTTGAATTAGCTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000895.3
Summary The protein encoded by this gene is an enzyme that contains both hydrolase and aminopeptidase activities. The hydrolase activity is used in the final step of the biosynthesis of leukotriene B4, a proinflammatory mediator. The aminopeptidase activity has been shown to degrade proline-glycine-proline (PGP), a neutrophil chemoattractant and biomarker for chronic obstructive pulmonary disease (COPD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Locus ID 4048
MW 10.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...