DDX39 (DDX39A) (NM_005804) Human 3' UTR Clone

CAT#: SC201502

3' UTR clone of DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 (DDX39) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name DDX39 (DDX39A) (NM_005804) Human 3' UTR Clone
Vector pMirTarget
Synonyms BAT1; BAT1L; DDX39; DDXL; URH49
ACCN NM_005804
Insert Size 168 bp
Sequence Data
>SC201502 3’UTR clone of NM_005804
The sequence shown below is from the reference sequence of NM_005804. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCTCCACATACATCGAGCAGAGCCGGTAACCACCACGTGCCAGAGCCGCCCACCCGGAGCCGCCCGCA
TGCAGCTTCACCTCCCCTTTCCAGGCGCCACTGTTGAGAAGCTAGAGATTGTATGAGAATAAACTTGTT
ATTATGGAAGCCTGGCTCCCACCCCATCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005804.4
Synonyms BAT1; BAT1L; DDX39; DDXL; URH49
Summary This gene encodes a member of the DEAD box protein family. These proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD) and are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is thought to play a role in the prognosis of patients with gastrointestinal stromal tumors. A pseudogene of this gene is present on chromosome 13. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
Locus ID 10212
MW 6.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...