MSH5 (NM_002441) Human 3' UTR Clone

CAT#: SC201466

3' UTR clone of mutS homolog 5 (E. coli) (MSH5) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MSH5 (NM_002441) Human 3' UTR Clone
Vector pMirTarget
Synonyms G7; MUTSH5; NG23; POF13
ACCN NM_002441
Insert Size 175 bp
Sequence Data
>SC201466 3’UTR clone of NM_002441
The sequence shown below is from the reference sequence of NM_002441. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGCTGCCTGCTGCCACCAGCATCCTCTGAGAGTCCTTCCAGTGTCCTCCCCAGCCTCCTGAGACTCCG
GTGGGCTGCCATGCCCTCTTTGTTTCCTTATCTCCCTCAGACGCAGAGTTTTTAGTTTCTCTAGAAATT
TTGTTTCATATTAGGAATAAAGTTTATTTTGAAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002441.5
Synonyms G7; MUTSH5; NG23; POF13
Summary This gene encodes a member of the mutS family of proteins that are involved in DNA mismatch repair and meiotic recombination. This protein is similar to a Saccharomyces cerevisiae protein that participates in segregation fidelity and crossing-over events during meiosis. This protein plays a role in promoting ionizing radiation-induced apoptosis. This protein forms hetero-oligomers with another member of this family, mutS homolog 4. Polymorphisms in this gene have been linked to various human diseases, including IgA deficiency, common variable immunodeficiency, and premature ovarian failure. Alternative splicing results multiple transcript variants. Read-through transcription also exists between this gene and the downstream chromosome 6 open reading frame 26 (C6orf26) gene. [provided by RefSeq, Feb 2011]
Locus ID 4439
MW 6.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...