Cathepsin W (CTSW) (NM_001335) Human 3' UTR Clone

CAT#: SC201460

3' UTR clone of cathepsin W (CTSW) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cathepsin W (CTSW) (NM_001335) Human 3' UTR Clone
Vector pMirTarget
Synonyms LYPN
ACCN NM_001335
Insert Size 153 bp
Sequence Data
>SC201460 3’UTR clone of NM_001335
The sequence shown below is from the reference sequence of NM_001335. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGAAGCCCCGAGTCTCCTGCCCTCCCTGAACCCACCTGGCCCCCTCAGCTCTGTCCTGTTAGGCCAAC
TGCCTCCTTGCCAGCCCCACCCCCAGGTTTTTGCCCATCCTCCCAATCTCAATACAGCCTGAATAAACC
AAGACAAGACCTCTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001335.4
Synonyms LYPN
Summary The protein encoded by this gene, a member of the peptidase C1 family, is a cysteine proteinase that may have a specific function in the mechanism or regulation of T-cell cytolytic activity. The encoded protein is found associated with the membrane inside the endoplasmic reticulum of natural killer and cytotoxic T-cells. Expression of this gene is up-regulated by interleukin-2. [provided by RefSeq, Jul 2008]
Locus ID 1521
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...