Cytochrome P450 2E1 (CYP2E1) (NM_000773) Human 3' UTR Clone

CAT#: SC201431

3' UTR clone of cytochrome P450 family 2 subfamily E polypeptide 1 (CYP2E1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cytochrome P450 2E1 (CYP2E1) (NM_000773) Human 3' UTR Clone
Vector pMirTarget
Synonyms CPE1; CYP2E; P450-J; P450C2E
ACCN NM_000773
Insert Size 189 bp
Sequence Data
>SC201431 3’UTR clone of NM_000773
The sequence shown below is from the reference sequence of NM_000773. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACAAACTCTGTGTCATTCCCCGCTCATGAGTGTGTGGAGGACACCCTGAACCCCCCGCTTTCAAACAA
GTTTTCAAATTGTTTGAGGTCAGGATTTCTCAAACTGATTCCTTTCTTTGCATATGAGTATTTGAAAAT
AAATATTTTCCCAGAATATAAATAAATCATCACATGATTATTTTAACTATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000773.4
Synonyms CPE1; CYP2E; P450-J; P450C2E
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer. [provided by RefSeq, Jul 2008]
Locus ID 1571
MW 7.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...