DNase I (DNASE1) (NM_005223) Human 3' UTR Clone

CAT#: SC201430

3' UTR clone of deoxyribonuclease I (DNASE1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DNase I (DNASE1) (NM_005223) Human 3' UTR Clone
Vector pMirTarget
Synonyms DNL1; DRNI
ACCN NM_005223
Insert Size 172 bp
Sequence Data
>SC201430 3’UTR clone of NM_005223
The sequence shown below is from the reference sequence of NM_005223. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACTATCCAGTGGAGGTGATGCTGAAGTGAGCAGCCCCTCCCCACACCAGTTGAACTGCAGGAAGAGAG
GACCCATCCTGCCACAGGACCCAGAAAAAAAGCCCAACACACACTCGGGTTAAGAAATACCTTTAAATT
TAGGTAAATAAAGCTCAAGGAGGTGGGGCTGTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005223.4
Synonyms DNL1; DRNI
Summary This gene encodes a member of the DNase family. This protein is stored in the zymogen granules of the nuclear envelope and functions by cleaving DNA in an endonucleolytic manner. At least six autosomal codominant alleles have been characterized, DNASE1*1 through DNASE1*6, and the sequence of DNASE1*2 represented in this record. Mutations in this gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. A recombinant form of this protein is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
Locus ID 1773
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...