GABPB2 (GABPB1) (NM_002041) Human 3' UTR Clone

CAT#: SC201419

3' UTR clone of GA binding protein transcription factor beta subunit 1 (GABPB1) transcript variant gamma-1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GABPB2 (GABPB1) (NM_002041) Human 3' UTR Clone
Vector pMirTarget
Synonyms BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4TF1B; GABPB; GABPB-1; GABPB2; NRF2B1; NRF2B2
ACCN NM_002041
Insert Size 166 bp
Sequence Data
>SC201419 3’UTR clone of NM_002041
The sequence shown below is from the reference sequence of NM_002041. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGTGTGCTTTGCCGCAGTCATCCAAAATAAATTCAATTTTTTTTGTCTTTTATATTTATTACTGACAGT
ATTGTTTTGATACAGAATGAAAGTGCGTAGTATTTTCATTTTGTTTATTTTTGCCTTATACATATAGCA
AGCCCTCAATAAATAAATATTGAATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002041.5
Synonyms BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4TF1B; GABPB; GABPB-1; GABPB2; NRF2B1; NRF2B2
Summary This gene encodes the GA-binding protein transcription factor, beta subunit. This protein forms a tetrameric complex with the alpha subunit, and stimulates transcription of target genes. The encoded protein may be involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. The crystal structure of a similar protein in mouse has been resolved as a ternary protein complex. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Locus ID 2553
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...