NDUFB3 (NM_002491) Human 3' UTR Clone

CAT#: SC201394

3' UTR clone of NADH dehydrogenase (ubiquinone) 1 beta subcomplex3 12kDa (NDUFB3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NDUFB3 (NM_002491) Human 3' UTR Clone
Vector pMirTarget
Synonyms B12; CI-B12; MC1DN25
ACCN NM_002491
Insert Size 165 bp
Sequence Data
>SC201394 3’UTR clone of NM_002491
The sequence shown below is from the reference sequence of NM_002491. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCCTGAATAAAGATAAGAAGCATCACTGAAGATAATACCTGGAAGCATCATAGTGGTTTCTTAACTCT
CCAAAATAAGATTTCTTCTCTGTAGCCTACTTGTCTGGTTTATCCCTTACAGAATATTAGTAAGATTTA
ATCAATTAAAATATATATATATGCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002491.3
Synonyms B12; CI-B12; MC1DN25
Summary This gene encodes an accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which is the first enzyme in the electron transport chain of mitochondria. This protein localizes to the inner membrane of the mitochondrion as a single-pass membrane protein. Mutations in this gene contribute to mitochondrial complex 1 deficiency. Alternative splicing results in multiple transcript variants encoding the same protein. Humans have multiple pseudogenes of this gene. [provided by RefSeq, Mar 2012]
Locus ID 4709
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...