CKMT2 (NM_001099736) Human 3' UTR Clone

CAT#: SC201365

3' UTR clone of creatine kinase mitochondrial 2 (sarcomeric) (CKMT2) nuclear gene encoding mitochondrial protein transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CKMT2 (NM_001099736) Human 3' UTR Clone
Vector pMirTarget
Synonyms SMTCK
ACCN NM_001099736
Insert Size 170 bp
Sequence Data
>SC201365 3’UTR clone of NM_001099736
The sequence shown below is from the reference sequence of NM_001099736. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCCCTCTGCCTCAGTTTGGCAAAAAGTAAACTTTCCCTTTCCCAATTTATAAATAATCTGTCTGCTGG
TACGACAGACATAAATCTCTACTCTGAGAGTTTTTATACACTTGGAAAAATATAAAATTGTAGATCCTG
CCTATCTTTACAATAAAACTCTCCTTAATATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001099736.2
Synonyms SMTCK
Summary Mitochondrial creatine kinase (MtCK) is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK and ubiquitous MtCK, encoded by separate genes. Mitochondrial creatine kinase occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Sarcomeric mitochondrial creatine kinase has 80% homology with the coding exons of ubiquitous mitochondrial creatine kinase. This gene contains sequences homologous to several motifs that are shared among some nuclear genes encoding mitochondrial proteins and thus may be essential for the coordinated activation of these genes during mitochondrial biogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 1160
MW 6.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...