COX17 (NM_005694) Human 3' UTR Clone

CAT#: SC201323

3' UTR clone of COX17 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX17) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name COX17 (NM_005694) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_005694
Insert Size 168 bp
Sequence Data
>SC201323 3’UTR clone of NM_005694
The sequence shown below is from the reference sequence of NM_005694. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGCATGAGAGCCCTAGGATTTAAAATATGAAATGGTGGTCTGCTGTGTGAATAAATAATTCCTGAAGAA
TGAAGAAGATTAATTTTGGGAGTTCTTTGACGAACTTTGATATGTGGAAAAAGTATTTATAATTTATTG
TAAGAAGAAAGTAAAATATTACTAGTGGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005694.2
Summary Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be involved in the recruitment of copper to mitochondria for incorporation into the COX apoenzyme. This protein shares 92% amino acid sequence identity with mouse and rat Cox17 proteins. This gene is no longer considered to be a candidate gene for COX deficiency. A pseudogene COX17P has been found on chromosome 13. [provided by RefSeq, Jul 2008]
Locus ID 10063
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...