Tapasin (TAPBP) (NM_172208) Human 3' UTR Clone

CAT#: SC201292

3' UTR clone of TAP binding protein (tapasin) (TAPBP) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Tapasin (TAPBP) (NM_172208) Human 3' UTR Clone
Vector pMirTarget
Synonyms NGS17; TAPA; TPN; TPSN
ACCN NM_172208
Insert Size 199 bp
Sequence Data
>SC201292 3’UTR clone of NM_172208
The sequence shown below is from the reference sequence of NM_172208. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTGTAGGACTCTTTGAGCATGCTACTTAATCTATATGTTTCCTTGGGTGTAGGGATTTTAAAAAGTTA
CTTAGGCAGTGCTGTCCAATAGAAAGATAATGCAAGCCACATATGTAAATTTAAATACTCTAGTACTCA
CATTAAAAAAATAAGCAGAAACAGGTAAAATTAACTTAATAATATACCTTATTTAATCTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_172208.3
Synonyms NGS17; TAPA; TPN; TPSN
Summary This gene encodes a transmembrane glycoprotein which mediates interaction between newly assembled major histocompatibility complex (MHC) class I molecules and the transporter associated with antigen processing (TAP), which is required for the transport of antigenic peptides across the endoplasmic reticulum membrane. This interaction is essential for optimal peptide loading on the MHC class I molecule. Up to four complexes of MHC class I and this protein may be bound to a single TAP molecule. This protein contains a C-terminal double-lysine motif (KKKAE) known to maintain membrane proteins in the endoplasmic reticulum. This gene lies within the major histocompatibility complex on chromosome 6. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Locus ID 6892
MW 7.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...