IGLL1 (NM_020070) Human 3' UTR Clone

CAT#: SC201271

3' UTR clone of immunoglobulin lambda-like polypeptide 1 (IGLL1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name IGLL1 (NM_020070) Human 3' UTR Clone
Vector pMirTarget
Synonyms 14.1; AGM2; CD179b; IGL1; IGL5; IGLJ14.1; IGLL; IGO; IGVPB; VPREB2
ACCN NM_020070
Insert Size 171 bp
Sequence Data
>SC201271 3’UTR clone of NM_020070
The sequence shown below is from the reference sequence of NM_020070. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGACGGTGGCCCCTGCAGAATGTTCATAGGTTCCCAGCCCCGACCCCACCCAAAGGGGCCTGGAGCTG
CAGGATCCCAGGGGAAGGGTCTCTCTCTGCATCCCAAGCCATCCAGCCCTTCTCCCTGTACCCAGTAAA
CCCTAAATAAATACCCTCTTTGTCAACCAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_020070.4
Synonyms 14.1; AGM2; CD179b; IGL1; IGL5; IGLJ14.1; IGLL; IGO; IGVPB; VPREB2
Summary The preB cell receptor is found on the surface of proB and preB cells, where it is involved in transduction of signals for cellular proliferation, differentiation from the proB cell to the preB cell stage, allelic exclusion at the Ig heavy chain gene locus, and promotion of Ig light chain gene rearrangements. The preB cell receptor is composed of a membrane-bound Ig mu heavy chain in association with a heterodimeric surrogate light chain. This gene encodes one of the surrogate light chain subunits and is a member of the immunoglobulin gene superfamily. This gene does not undergo rearrangement. Mutations in this gene can result in B cell deficiency and agammaglobulinemia, an autosomal recessive disease in which few or no gamma globulins or antibodies are made. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 3543
MW 6.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...