CATSPER2 (NM_054020) Human 3' UTR Clone

CAT#: SC201236

3' UTR clone of cation channel sperm associated 2 (CATSPER2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CATSPER2 (NM_054020) Human 3' UTR Clone
Vector pMirTarget
Synonyms MGC33346
ACCN NM_054020
Insert Size 169 bp
Sequence Data
>SC201236 3’UTR clone of NM_054020
The sequence shown below is from the reference sequence of NM_054020. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGCACTGATGAACTTGGAAGACAAGTAAAGCAATGGATGGCTTCAATATCCTTGGGCCCAGCAAAAG
ATAATGAAGGGAATTGTTGGAAATAGAGAATTGAAAATATAAACATTCAGATAGAACAATGTCTGTTCA
TTAAAATTAAAAAGTATAAGTGTCTAGGCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_054020.3
Synonyms MGC33346
Summary This gene encodes a member of a family of cation channel proteins that localize to the flagellum of spermatozoa. Defects at this locus causes male infertility. Alternatively spliced transcript variants have been observed at this locus. Readthrough transcription originates upstream of this locus in diphosphoinositol pentakisphosphate kinase 1 pseudogene 1 and is represented by GeneID:110006325. Related pseudogenes are found next to this locus on chromosome 15 and on chromosome 5. [provided by RefSeq, Mar 2017]
Locus ID 117155
MW 6.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...