ACOT1 (NM_001037161) Human 3' UTR Clone

CAT#: SC201224

3' UTR clone of acyl-CoA thioesterase 1 (ACOT1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ACOT1 (NM_001037161) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACH2; CTE-1; LACH2
ACCN NM_001037161
Insert Size 171 bp
Sequence Data
>SC201224 3’UTR clone of NM_001037161
The sequence shown below is from the reference sequence of NM_001037161. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACGAGGGGACAATCCCATCAAAAGTGTAAATTTTATTTGATCATGTGGCCTCTCTGTTGCTAATCTCT
CCTGGAAACATCTGCCACATTTAGTGTGTGTATGTGTATTCATTCTTTCTCATAACTTCTTAAAGTTTC
TTCCCCTCATTATTAAAATGAATTTACCAGTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001037161.2
Synonyms ACH2; CTE-1; LACH2
Summary Acyl-CoA thioesterases are a group of enzymes that catalyze the hydrolysis of acyl-CoAs into free fatty acids and coenzyme A (CoASH), regulating intracellular levels of acyl-CoAs, free fatty acids and CoASH. More active towards saturated and unsaturated long chain fatty acyl-CoAs (C12-C20).[UniProtKB/Swiss-Prot Function]
Locus ID 641371
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...