ACTN3 (NM_001104) Human 3' UTR Clone

CAT#: SC201154

3' UTR clone of actinin alpha 3 (ACTN3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ACTN3 (NM_001104) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACTN3D
ACCN NM_001104
Insert Size 171 bp
Sequence Data
>SC201154 3’UTR clone of NM_001104
The sequence shown below is from the reference sequence of NM_001104. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGTGCCCTCTATGGGGAGAGCGACCTTTGACCCCAACCACTGAGGTTCTCTATGCAAGATGGAGAGAGG
ATGCACCCTGTGGCTGATCCCATCCGTCCCTCGGAGCAAGGGCCTAAGAGAAAAGCCAGCCAAGTGCTT
CTGAATAAAGATCCCTCTCTGGGTCTCTCCCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001104.4
Synonyms ACTN3D
Summary This gene encodes a member of the alpha-actin binding protein gene family. The encoded protein is primarily expressed in skeletal muscle and functions as a structural component of sarcomeric Z line. This protein is involved in crosslinking actin containing thin filaments. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the coding allele. The non-functional allele of this gene is associated with elite athlete status. [provided by RefSeq, Feb 2014]
Locus ID 89
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...