AUTS2 (NM_001127232) Human 3' UTR Clone

CAT#: SC201151

3' UTR clone of autism susceptibility candidate 2 (AUTS2) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AUTS2 (NM_001127232) Human 3' UTR Clone
Vector pMirTarget
Synonyms FBRSL2; MRD26
ACCN NM_001127232
Insert Size 117 bp
Sequence Data
>SC201151 3' UTR clone of NM_001127232
The sequence shown below is from the reference sequence of NM_001127232. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCTCGTCAAATTGCTTAAAGGATTCTAGTTCCGTTTGGTGTGGTCACTCACATTTGAATTCTAATACTCT
ATGTGATATAGATTCTGTTGACTACTGTTAGCGTGACCCCAATGAGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001127232.1
Synonyms FBRSL2; MRD26
Summary This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
Locus ID 26053
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...