ZNF165 (NM_003447) Human 3' UTR Clone

CAT#: SC200999

3' UTR clone of zinc finger protein 165 (ZNF165) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ZNF165 (NM_003447) Human 3' UTR Clone
Vector pMirTarget
Synonyms CT53; LD65; ZSCAN7
ACCN NM_003447
Insert Size 123 bp
Sequence Data
>SC200999 3’UTR clone of NM_003447
The sequence shown below is from the reference sequence of NM_003447. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATTCACATGAGGGAAAACCTATTAATGTAAGGAACTTAAATTTGTAAGTAAATGCTGAGGAAATGGCAC
AATATGAAAAATATTAAATAAAAAATAAATATTGGGCAAGATGGAAGACTGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003447.4
Synonyms CT53; LD65; ZSCAN7
Summary This gene encodes a member of the Kruppel family of zinc finger proteins. Members of this DNA-binding protein family act as transcriptional regulators. This gene is located within a cluster of zinc finger family members. The encoded protein may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
Locus ID 7718
MW 4.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...