alpha Defensin 1 (DEFA1) (NM_004084) Human 3' UTR Clone

CAT#: SC200996

3' UTR clone of defensin alpha 1 (DEFA1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name alpha Defensin 1 (DEFA1) (NM_004084) Human 3' UTR Clone
Vector pMirTarget
Synonyms DEF1; DEFA2; HNP-1; HP-1; HP1; MRS
ACCN NM_004084
Insert Size 151 bp
Sequence Data
>SC200996 3’UTR clone of NM_004084
The sequence shown below is from the reference sequence of NM_004084. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGGAAGACTCTGGGCATTCTGCTGCTGAGCTTGCAGAAAAAGAAAAATGAGCTCAAAATTTGCTTTG
AGAGCTACAGGGAATTGCTATTACTCCTGTACCTTCTGCTCAATTTCCTTTCCTCATCCCAAATAAATG
CCTTGTTACAAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004084.4
Synonyms DEF1; DEFA2; HNP-1; HP-1; HP1; MRS
Summary Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. The protein encoded by this gene, defensin, alpha 1, is found in the microbicidal granules of neutrophils and likely plays a role in phagocyte-mediated host defense. Several alpha defensin genes are clustered on chromosome 8. This gene differs from defensin, alpha 3 by only one amino acid. This gene and the gene encoding defensin, alpha 3 are both subject to copy number variation. [provided by RefSeq, Oct 2014]
Locus ID 1667
MW 5.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...