MIF (NM_002415) Human 3' UTR Clone

CAT#: SC200873

3' UTR clone of macrophage migration inhibitory factor (glycosylation-inhibiting factor) (MIF) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MIF (NM_002415) Human 3' UTR Clone
Vector pMirTarget
Synonyms GIF; GLIF; MMIF
ACCN NM_002415
Insert Size 147 bp
Sequence Data
>SC200873 3’UTR clone of NM_002415
The sequence shown below is from the reference sequence of NM_002415. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGGGCTGGAACAACTCCACCTTCGCCTAAGAGCCGCAGGGACCCACGCTGTCTGCGCTGGCTCCACCC
GGGAACCCGCCGCACGCTGTGTTCTAGGCCCGCCCACCCCAACCTTCTGGTGGGGAGAAATAAACGGTT
TAGAGACTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002415.2
Synonyms GIF; GLIF; MMIF
Summary This gene encodes a lymphokine involved in cell-mediated immunity, immunoregulation, and inflammation. It plays a role in the regulation of macrophage function in host defense through the suppression of anti-inflammatory effects of glucocorticoids. This lymphokine and the JAB1 protein form a complex in the cytosol near the peripheral plasma membrane, which may indicate an additional role in integrin signaling pathways. [provided by RefSeq, Jul 2008]
Locus ID 4282
MW 5.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...