PHF10 (NM_018288) Human 3' UTR Clone

CAT#: SC200872

3' UTR clone of PHD finger protein 10 (PHF10) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PHF10 (NM_018288) Human 3' UTR Clone
Vector pMirTarget
Synonyms BAF45A; XAP135
ACCN NM_018288
Insert Size 131 bp
Sequence Data
>SC200872 3’UTR clone of NM_018288
The sequence shown below is from the reference sequence of NM_018288. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAAGGGGGAAAAACAGCAAAGAGGGATAAAATAGTTTTTGACTCTAATACTGTATATGCATTTAAGTG
GAATATTTGGTGCCATTTACAACATTATTTTCATGCCAATAAAAGATTTTTTTTGCAAATTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018288.4
Synonyms BAF45A; XAP135
Summary This gene contains a predicted ORF that encodes a protein with two zinc finger domains. The function of the encoded protein is not known. Sequence analysis suggests that multiple alternatively spliced transcript variants are derived from this gene but the full-length nature of only two of them is known. These two splice variants encode different isoforms. A pseudogene for this gene is located on Xq28. [provided by RefSeq, Jul 2008]
Locus ID 55274
MW 5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...