XPD (ERCC2) (NM_001130867) Human 3' UTR Clone

CAT#: SC200830

3' UTR clone of excision repair cross-complementing rodent repair deficiency complementation group 2 (ERCC2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name XPD (ERCC2) (NM_001130867) Human 3' UTR Clone
Vector pMirTarget
Synonyms COFS2; EM9; TFIIH; TTD; TTD1; XPD
ACCN NM_001130867
Insert Size 108 bp
Sequence Data
>SC200830 3’UTR clone of NM_001130867
The sequence shown below is from the reference sequence of NM_001130867. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCAGGAACCAAAAAAGATCTCATCCCTAACCCCCCAGAACTTATATTCCAGATGGGAAAACCAGTAGC
AAAGATGCAGCCAAATAAACAAGGAAATAATTCCAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001130867.2
Synonyms COFS2; EM9; TFIIH; TTD; TTD1; XPD
Summary The nucleotide excision repair pathway is a mechanism to repair damage to DNA. The protein encoded by this gene is involved in transcription-coupled nucleotide excision repair and is an integral member of the basal transcription factor BTF2/TFIIH complex. The gene product has ATP-dependent DNA helicase activity and belongs to the RAD3/XPD subfamily of helicases. Defects in this gene can result in three different disorders, the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Locus ID 2068
MW 4.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...