DNA polymerase delta p50 (POLD2) (NM_001127218) Human 3' UTR Clone

CAT#: SC200815

3' UTR clone of polymerase (DNA directed) delta 2 regulatory subunit 50kDa (POLD2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name DNA polymerase delta p50 (POLD2) (NM_001127218) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_001127218
Insert Size 135 bp
Sequence Data
>SC200815 3’UTR clone of NM_001127218
The sequence shown below is from the reference sequence of NM_001127218. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCTGGGAGGCCTGGGGCTGGGCCCCTGACTCAAAAAAGTGGTTTTGACCAGAGAGGCCCAGATGGAG
GCTGTTCATTCCCTGCAGTGTCGGCATTGTAAATAAAGCCTGAGCACTTGCTGATGCGAGCCTTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001127218.3
Summary This gene encodes the 50-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein is required for the stimulation of DNA polymerase delta activity by the processivity cofactor proliferating cell nuclear antigen (PCNA). Expression of this gene may be a marker for ovarian carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Mar 2012]
Locus ID 5425
MW 4.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...