Caspase 4 (CASP4) (NM_001225) Human 3' UTR Clone

CAT#: SC200807

3' UTR clone of caspase 4 apoptosis-related cysteine peptidase (CASP4) transcript variant alpha for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Caspase 4 (CASP4) (NM_001225) Human 3' UTR Clone
Vector pMirTarget
Synonyms ICE(rel)II; ICEREL-II; ICH-2; Mih1; Mih1/TX; TX
ACCN NM_001225
Insert Size 143 bp
Sequence Data
>SC200807 3’UTR clone of NM_001225
The sequence shown below is from the reference sequence of NM_001225. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGATATTTCTACCTCTTTCCTGGCAATTGAAAATGGAAGCCACAAGCAGCCCAGCCCTCCTTAATCAAC
TTCAAGGAGCACCTTCATTAGTACAGCTTGCATATTTAACATTTTGTATTTCAATAAAAGTGAAGACAA
ACGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001225.4
Synonyms ICE(rel)II; ICEREL-II; ICH-2; Mih1; Mih1/TX; TX
Summary This gene encodes a protein that is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain and a large and small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This caspase is able to cleave and activate its own precursor protein, as well as caspase 1 precursor. When overexpressed, this gene induces cell apoptosis. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Locus ID 837
MW 5.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...