Cytochrome P450 3A5 (CYP3A5) (NM_000777) Human 3' UTR Clone

CAT#: SC200791

3' UTR clone of cytochrome P450 family 3 subfamily A polypeptide 5 (CYP3A5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cytochrome P450 3A5 (CYP3A5) (NM_000777) Human 3' UTR Clone
Vector pMirTarget
Synonyms CP35; CYPIIIA5; P450PCN3; PCN3
ACCN NM_000777
Insert Size 141 bp
Sequence Data
>SC200791 3’UTR clone of NM_000777
The sequence shown below is from the reference sequence of NM_000777. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCAAGAGATGGAACCCTAAGTGGAGAATGAGTTATTCTAAGGATTTCTACTTTGGTCTTCAAGAAAGCT
GTGCCCCAGAACACCAGAGATTTCAACTTAGTCAATAAAACCTTGAAATAAAGATGGGCTTAATCTAAT
GTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000777.5
Synonyms CP35; CYPIIIA5; P450PCN3; PCN3
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein metabolizes drugs as well as the steroid hormones testosterone and progesterone. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Two pseudogenes of this gene have been identified within this cluster on chromosome 7. Expression of this gene is widely variable among populations, and a single nucleotide polymorphism that affects transcript splicing has been associated with susceptibility to hypertensions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Locus ID 1577
MW 5.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...