MGST2 (NM_002413) Human 3' UTR Clone

CAT#: SC200705

3' UTR clone of microsomal glutathione S-transferase 2 (MGST2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MGST2 (NM_002413) Human 3' UTR Clone
Vector pMirTarget
Synonyms GST2; MGST-II
ACCN NM_002413
Insert Size 125 bp
Sequence Data
>SC200705 3’UTR clone of NM_002413
The sequence shown below is from the reference sequence of NM_002413. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATTGCCAAGAAACTGAGGCGGCAATTCTAACTTTTTCTCTTCCCTTTAATACTTGCAGAAGCTGTTCCC
ACCATGAAGGTAATATGGTATCATTTGTTAAATAAAAATAAAGTCTTTATTCTGTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002413.5
Synonyms GST2; MGST-II
Summary The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, several of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes a protein which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2011]
Locus ID 4258
MW 4.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...