DNA Ligase III (LIG3) (NM_002311) Human 3' UTR Clone

CAT#: SC200642

3' UTR clone of ligase III DNA ATP-dependent (LIG3) nuclear gene encoding mitochondrial protein transcript variant beta for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 10 publications.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name DNA Ligase III (LIG3) (NM_002311) Human 3' UTR Clone
Vector pMirTarget
Synonyms LIG2; LIG3alpha
ACCN NM_002311
Insert Size 135 bp
Sequence Data
>SC200642 3’UTR clone of NM_002311
The sequence shown below is from the reference sequence of NM_002311. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGAAGAACTGTGCCAGCAGGCAGGAGATAGAACAGCCCGGCCTAGCCAGGAGAGACTGCAGGGACTCAC
TCAGCTGCTGGCCCCAAGTCAAAATTTACATTAAAGGGAAAAGACCAGTCTGGGTGTGGGAATGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002311.5
Synonyms LIG2; LIG3alpha
Summary This gene is a member of the DNA ligase family. Each member of this family encodes a protein that catalyzes the joining of DNA ends but they each have a distinct role in DNA metabolism. The protein encoded by this gene is involved in excision repair and is located in both the mitochondria and nucleus, with translation initiation from the upstream start codon allowing for transport to the mitochondria and translation initiation from a downstream start codon allowing for transport to the nucleus. Additionally, alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Locus ID 3980
MW 4.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (10)

Documents

Customer Reviews 
Loading...