TCIRG1 (NM_006053) Human 3' UTR Clone

CAT#: SC200604

3' UTR clone of T-cell immune regulator 1 ATPase H+ transporting lysosomal V0 subunit A3 (TCIRG1) transcript variant 2



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name TCIRG1 (NM_006053) Human 3' UTR Clone
Vector pMirTarget
Synonyms a3; Atp6i; ATP6N1C; ATP6V0A3; OC-116kDa; OC116; OPTB1; Stv1; TIRC7; Vph1
ACCN NM_006053
Insert Size 106 bp
Sequence Data
>SC200604 3’UTR clone of NM_006053
The sequence shown below is from the reference sequence of NM_006053. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCTTCACCTTCGCTGCCACAGATGACTAGGGCCCACTGCAGGTCCTGCCAGACCTCCTTCCTGACCTC
TGAGGCAGGAGAGGAATAAAGACGGTCCGCCCTGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006053.4
Synonyms a3; Atp6i; ATP6N1C; ATP6V0A3; OC-116kDa; OC116; OPTB1; Stv1; TIRC7; Vph1
Summary This gene encodes a subunit of a large protein complex known as a vacuolar H+-ATPase (V-ATPase). The protein complex acts as a pump to move protons across the membrane. This movement of protons helps regulate the pH of cells and their surrounding environment. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Alternative splicing results in multiple transcript variants. Mutations in this gene are associated with infantile malignant osteopetrosis. [provided by RefSeq, May 2017]
Locus ID 10312
MW 3.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...