ARHGAP11B (NM_001039841) Human 3' UTR Clone

CAT#: SC200555

3' UTR clone of Rho GTPase activating protein 11B (ARHGAP11B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ARHGAP11B (NM_001039841) Human 3' UTR Clone
Vector pMirTarget
Synonyms B'-T; FAM7B1; GAP (1-8)
ACCN NM_001039841
Insert Size 98 bp
Sequence Data
>SC200555 3’UTR clone of NM_001039841
The sequence shown below is from the reference sequence of NM_001039841. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AATATAAGAGAAAGAGAAGACAACGTGTAGGAGATTTTGTTAGTGGAGCACTAAATAAATTTAAACCTA
ACAGAACACCTTCTATTACACCTCAACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001039841.3
Synonyms B'-T; FAM7B1; GAP (1-8)
Summary Hominin-specific protein that promotes development and evolutionary expansion of the brain neocortex (PubMed:25721503). Able to promote amplification of basal progenitors in the subventricular zone, producing more neurons during fetal corticogenesis (PubMed:25721503). Does not possess GTPase activator activity (PubMed:25721503).[UniProtKB/Swiss-Prot Function]
Locus ID 89839
MW 3.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...