BCL2 (NM_000657) Human 3' UTR Clone

CAT#: SC200550

3' UTR clone of B-cell CLL/lymphoma 2 (BCL2) nuclear gene encoding mitochondrial protein transcript variant beta for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name BCL2 (NM_000657) Human 3' UTR Clone
Vector pMirTarget
Synonyms Bcl-2; PPP1R50
ACCN NM_000657
Insert Size 125 bp
Sequence Data
>SC200550 3’UTR clone of NM_000657
The sequence shown below is from the reference sequence of NM_000657. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGTGCACTTGGTGATGTGAGTCTGGGCTGAGGCCACAGGTCCGAGATGCGGGGGTTGGAGTGCGGGTGG
GCTCCTGGGGCAATGGGAGGCTGTGGAGCCGGCGAAATAAAATCAGAGTTGTTGCT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000657.3
Synonyms Bcl-2; PPP1R50
Summary This gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Locus ID 596
MW 4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...