NDUFS3 (NM_004551) Human 3' UTR Clone

CAT#: SC200525

3' UTR clone of NADH dehydrogenase (ubiquinone) Fe-S protein 3 30kDa (NADH-coenzyme Q reductase) (NDUFS3) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NDUFS3 (NM_004551) Human 3' UTR Clone
Vector pMirTarget
Synonyms CI-30; MC1DN8
ACCN NM_004551
Insert Size 111 bp
Sequence Data
>SC200525 3’UTR clone of NM_004551
The sequence shown below is from the reference sequence of NM_004551. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCGGAGACAAGAAGCCTGATGCCAAGTAGCTCCAGGGAACGCATGTGGATCCTAGACAGCGCCTTATC
TATGATTGAGTGTCCGTGTAAATAAATTCCTACTTAGACTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004551.3
Synonyms CI-30; MC1DN8
Summary This gene encodes one of the iron-sulfur protein (IP) components of mitochondrial NADH:ubiquinone oxidoreductase (complex I). Mutations in this gene are associated with Leigh syndrome resulting from mitochondrial complex I deficiency.[provided by RefSeq, Apr 2009]
Locus ID 4722
MW 4.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...