LRRC50 (DNAAF1) (NM_178452) Human 3' UTR Clone

CAT#: SC200497

3' UTR clone of leucine rich repeat containing 50 (LRRC50) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name LRRC50 (DNAAF1) (NM_178452) Human 3' UTR Clone
Vector pMirTarget
Synonyms CILD13; DAU1; LRRC50; ODA7; swt
ACCN NM_178452
Insert Size 107 bp
Sequence Data
>SC200497 3’UTR clone of NM_178452
The sequence shown below is from the reference sequence of NM_178452. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTGCATTCCCAGCACCGAAAGCATCATAGTTTTCCCCAGTTATATGTAGCATAAATGGTTTAATCATA
AATGTCTCCCTTAGGCATGATAAACATTTTAACACCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_178452.6
Synonyms CILD13; DAU1; LRRC50; ODA7; swt
Summary The protein encoded by this gene is cilium-specific and is required for the stability of the ciliary architecture. It is involved in the regulation of microtubule-based cilia and actin-based brush border microvilli. Mutations in this gene are associated with primary ciliary dyskinesia-13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Locus ID 123872
MW 3.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...