DYDC1 (NM_138812) Human 3' UTR Clone

CAT#: SC200490

3' UTR clone of DPY30 domain containing 1 (DYDC1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DYDC1 (NM_138812) Human 3' UTR Clone
Vector pMirTarget
Synonyms DPY30D1
ACCN NM_138812
Insert Size 81 bp
Sequence Data
>SC200490 3’UTR clone of NM_138812
The sequence shown below is from the reference sequence of NM_138812. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATTGCATTAAACATTGATCAAGATTTGTAGGACCAACCAACCTAAGAGCAATAAATGTTTTTGTTTGTT
TCAAATTTCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_138812.4
Synonyms DPY30D1
Summary This gene encodes a member of a family of proteins that contains a DPY30 domain. The encoded protein is involved in acrosome formation during spermatid development. This gene locus overlaps with a closely related gene on the opposite strand. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Locus ID 143241
MW 3.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...