CYP4F12 (NM_023944) Human 3' UTR Clone

CAT#: SC200467

3' UTR clone of cytochrome P450 family 4 subfamily F polypeptide 12 (CYP4F12) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CYP4F12 (NM_023944) Human 3' UTR Clone
Vector pMirTarget
Synonyms CYPIVF12; F22329_1
ACCN NM_023944
Insert Size 119 bp
Sequence Data
>SC200467 3’UTR clone of NM_023944
The sequence shown below is from the reference sequence of NM_023944. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGGAGCCCCTGAATGTAAGCTTGCAGTGACTTTCTGACCCATCCACCTGTTTTTTTGCAGATTGTCAT
GAATAAAACGGTGCTGTCACCTCTGCCTGGGCCTCACTGACAGCCTGCAG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_023944.4
Synonyms CYPIVF12; F22329_1
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein likely localizes to the endoplasmic reticulum. When expressed in yeast the enzyme is capable of oxdizing arachidonic acid. It can also catalyze the epoxidation of 22:6n-3 and 22:5n-3 polyunsaturated long-chain fatty acids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Locus ID 66002
MW 4.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...