Cytochrome P450 2D6 (CYP2D6) (NM_001025161) Human 3' UTR Clone

CAT#: SC200465

3' UTR clone of cytochrome P450 family 2 subfamily D polypeptide 6 (CYP2D6) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cytochrome P450 2D6 (CYP2D6) (NM_001025161) Human 3' UTR Clone
Vector pMirTarget
Synonyms CPD6; CYP2D; CYP2D7AP; CYP2D7BP; CYP2D7P2; CYP2D8P2; CYP2DL1; CYPIID6; P450-DB1; P450C2D; P450DB1
ACCN NM_001025161
Insert Size 105 bp
Sequence Data
>SC200465 3’UTR clone of NM_001025161
The sequence shown below is from the reference sequence of NM_001025161. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCTATGAGCTTTGTGCTGTGCCCCGCTAGAATGGGGTACCTAGTCCCCAGCCTGCTCCCTAGCCAGAG
GCTCTAATGTACAATAAAGCAATGTGGTAGTTCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001025161.3
Synonyms CPD6; CYP2D; CYP2D7AP; CYP2D7BP; CYP2D7P2; CYP2D8P2; CYP2DL1; CYPIID6; P450-DB1; P450C2D; P450DB1
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to metabolize as many as 25% of commonly prescribed drugs. Its substrates include antidepressants, antipsychotics, analgesics and antitussives, beta adrenergic blocking agents, antiarrythmics and antiemetics. The gene is highly polymorphic in the human population; certain alleles result in the poor metabolizer phenotype, characterized by a decreased ability to metabolize the enzyme's substrates. Some individuals with the poor metabolizer phenotype have no functional protein since they carry 2 null alleles whereas in other individuals the gene is absent. This gene can vary in copy number and individuals with the ultrarapid metabolizer phenotype can have 3 or more active copies of the gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Locus ID 1565
MW 4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...