Cathelicidin (CAMP) (NM_004345) Human 3' UTR Clone

CAT#: SC200431

3' UTR clone of cathelicidin antimicrobial peptide (CAMP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cathelicidin (CAMP) (NM_004345) Human 3' UTR Clone
Vector pMirTarget
Synonyms CAP-18; CAP18; CRAMP; FALL-39; FALL39; HSD26; LL37
ACCN NM_004345
Insert Size 91 bp
Sequence Data
>SC200431 3’UTR clone of NM_004345
The sequence shown below is from the reference sequence of NM_004345. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGGAATCTTGTACCCAGGACAGAGTCCTAGTGTGTGCCCTACCCTGGCTCAGGCTTCTGGGCTCTGAGA
AATAAACTATGAGAGCAATTTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004345.5
Synonyms CAP-18; CAP18; CRAMP; FALL-39; FALL39; HSD26; LL37
Summary This gene encodes a member of an antimicrobial peptide family, characterized by a highly conserved N-terminal signal peptide containing a cathelin domain and a structurally variable cationic antimicrobial peptide, which is produced by extracellular proteolysis from the C-terminus. In addition to its antibacterial, antifungal, and antiviral activities, the encoded protein functions in cell chemotaxis, immune mediator induction, and inflammatory response regulation. [provided by RefSeq, Sep 2014]
Locus ID 820
MW 3.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...