RUVBL2 (NM_006666) Human 3' UTR Clone

CAT#: SC200395

3' UTR clone of RuvB-like 2 (E. coli) (RUVBL2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RUVBL2 (NM_006666) Human 3' UTR Clone
Vector pMirTarget
Synonyms CGI-46; ECP-51; ECP51; INO80J; REPTIN; RVB2; TAP54-beta; TIH2; TIP48; TIP49B
ACCN NM_006666
Insert Size 158 bp
Sequence Data
>SC200395 3’UTR clone of NM_006666
The sequence shown below is from the reference sequence of NM_006666. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCAAAGGCGAGACCATGGACACCTCCTGAGTTGGATGTCATCCCCCGACCCCACCCTGTTTTCCACCA
GAGTTCTGACACTGTGACTCTGTATAAAATGGTTGGGAAGCTGCACCCACCCTGTGTATGTGTGGTTGC
CCTGAGCCCACAGAAAGACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006666.3
Synonyms CGI-46; ECP-51; ECP51; INO80J; REPTIN; RVB2; TAP54-beta; TIH2; TIP48; TIP49B
Summary This gene encodes the second human homologue of the bacterial RuvB gene. Bacterial RuvB protein is a DNA helicase essential for homologous recombination and DNA double-strand break repair. Functional analysis showed that this gene product has both ATPase and DNA helicase activities. This gene is physically linked to the CGB/LHB gene cluster on chromosome 19q13.3, and is very close (55 nt) to the LHB gene, in the opposite orientation. [provided by RefSeq, Jul 2008]
Locus ID 10856
MW 5.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...