ATP5PO (NM_001697) Human 3' UTR Clone

CAT#: SC200379

3' UTR clone of ATP synthase H+ transporting mitochondrial F1 complex O subunit (ATP5O) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ATP5PO (NM_001697) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATP5O; ATPO; HMC08D05; OSCP
ACCN NM_001697
Insert Size 103 bp
Sequence Data
>SC200379 3’UTR clone of NM_001697
The sequence shown below is from the reference sequence of NM_001697. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGGCAGGGCTATGCGGGAGATTGTCTAAAAGTGTTGGTTTTCTGCCATCAGTGAAAATTCTTAAACT
TGGAGCAACAATAAAAAGCTTCCAGAACAGATCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001697.3
Synonyms ATP5O; ATPO; HMC08D05; OSCP
Summary The protein encoded by this gene is a component of the F-type ATPase found in the mitochondrial matrix. F-type ATPases are composed of a catalytic core and a membrane proton channel. The encoded protein appears to be part of the connector linking these two components and may be involved in transmission of conformational changes or proton conductance. [provided by RefSeq, Jul 2008]
Locus ID 539
MW 4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...