C3ORF31 (TAMM41) (NM_138807) Human 3' UTR Clone

CAT#: SC200315

3' UTR clone of chromosome 3 open reading frame 31 (C3orf31) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name C3ORF31 (TAMM41) (NM_138807) Human 3' UTR Clone
Vector pMirTarget
Synonyms C3orf31; RAM41; TAM41
ACCN NM_138807
Insert Size 93 bp
Sequence Data
>SC200315 3’UTR clone of NM_138807
The sequence shown below is from the reference sequence of NM_138807. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGAAAGGGTGGCTGAGGAAAACATCCTGATTTTGCTTGCTTTTATATATGTTATGTGTAGATGAATAA
AGTGTTTGATCCTTTTTGACAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_138807.4
Synonyms C3orf31; RAM41; TAM41
Summary Catalyzes the formation of CDP-diacylglycerol (CDP-DAG) from phosphatidic acid (PA) in the mitochondrial inner membrane. Required for the biosynthesis of the dimeric phospholipid cardiolipin, which stabilizes supercomplexes of the mitochondrial respiratory chain in the mitochondrial inner membrane.[UniProtKB/Swiss-Prot Function]
Locus ID 132001
MW 3.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...