IMPDH2 (NM_000884) Human 3' UTR Clone

CAT#: SC200296

3' UTR clone of IMP (inosine monophosphate) dehydrogenase 2 (IMPDH2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name IMPDH2 (NM_000884) Human 3' UTR Clone
Vector pMirTarget
Synonyms IMPD2; IMPDH-II
ACCN NM_000884
Insert Size 88 bp
Sequence Data
>SC200296 3’UTR clone of NM_000884
The sequence shown below is from the reference sequence of NM_000884. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCCATTCGTATGAGAAGCGGCTTTTCTGAAAAGGGATCCAGCACACCTCCTCGGTTTTTTTTTCAATA
AAAGTTTAGAAAGAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000884.3
Synonyms IMPD2; IMPDH-II
Summary This gene encodes the rate-limiting enzyme in the de novo guanine nucleotide biosynthesis. It is thus involved in maintaining cellular guanine deoxy- and ribonucleotide pools needed for DNA and RNA synthesis. The encoded protein catalyzes the NAD-dependent oxidation of inosine-5'-monophosphate into xanthine-5'-monophosphate, which is then converted into guanosine-5'-monophosphate. This gene is up-regulated in some neoplasms, suggesting it may play a role in malignant transformation. [provided by RefSeq, Jul 2008]
Locus ID 3615
MW 3.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...