NDUFS8 (NM_002496) Human 3' UTR Clone

CAT#: SC200283

3' UTR clone of NADH dehydrogenase (ubiquinone) Fe-S protein 8 23kDa (NADH-coenzyme Q reductase) (NDUFS8) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NDUFS8 (NM_002496) Human 3' UTR Clone
Vector pMirTarget
Synonyms CI-23k; CI23KD; MC1DN2; TYKY
ACCN NM_002496
Insert Size 81 bp
Sequence Data
>SC200283 3’UTR clone of NM_002496
The sequence shown below is from the reference sequence of NM_002496. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACATCCAGGCTGACTACTTGTATCGGTGACGCCCCACCGGCCCGCAGCCCCTGCTGCCCAATAAAACC
ACTCCGACCCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002496.4
Synonyms CI-23k; CI23KD; MC1DN2; TYKY
Summary This gene encodes a subunit of mitochondrial NADH:ubiquinone oxidoreductase, or Complex I, a multimeric enzyme of the respiratory chain responsible for NADH oxidation, ubiquinone reduction, and the ejection of protons from mitochondria. The encoded protein is involved in the binding of two of the six to eight iron-sulfur clusters of Complex I and, as such, is required in the electron transfer process. Mutations in this gene have been associated with Leigh syndrome. [provided by RefSeq, Mar 2010]
Locus ID 4728
MW 3.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...