Kindlin 2 (FERMT2) (NM_001135000) Human 3' UTR Clone

CAT#: SC200272

3' UTR clone of fermitin family homolog 2 (Drosophila) (FERMT2) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Kindlin 2 (FERMT2) (NM_001135000) Human 3' UTR Clone
Vector pMirTarget
Synonyms KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B
ACCN NM_001135000
Insert Size 285 bp
Sequence Data
>SC200272 3’UTR clone of NM_001135000
The sequence shown below is from the reference sequence of NM_001135000. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACTGGGAAATCAAAATGGTAAACTCATAACAATGTTACTTGAATATAGTCCTTCTCTGATACAAATTA
GTACATTAAGAATAAAAAGGCCTATAAATTCTGATGATTATTTGTACCACCACCTCTTAAAGTACAGAC
AGACCATGGTTGACTATTCATTTCTCACTTAAATTTGCCTATTTCATAATTAGCCCAGTTACTAAAATT
CTAAGTGCATAATTTGCTTAGAATGTTGCCTTTTTTGTCTTTCTGTAATGGATAAAGCCGATCTACTCT
GAAATAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001135000.2
Synonyms KIND2; mig-2; MIG2; PLEKHC1; UNC112; UNC112B
Summary Scaffolding protein that enhances integrin activation mediated by TLN1 and/or TLN2, but activates integrins only weakly by itself. Binds to membranes enriched in phosphoinositides. Enhances integrin-mediated cell adhesion onto the extracellular matrix and cell spreading; this requires both its ability to interact with integrins and with phospholipid membranes. Required for the assembly of focal adhesions. Participates in the connection between extracellular matrix adhesion sites and the actin cytoskeleton and also in the orchestration of actin assembly and cell shape modulation. Recruits FBLIM1 to focal adhesions. Plays a role in the TGFB1 and integrin signaling pathways. Stabilizes active CTNNB1 and plays a role in the regulation of transcription mediated by CTNNB1 and TCF7L2/TCF4 and in Wnt signaling.[UniProtKB/Swiss-Prot Function]
Locus ID 10979
MW 11.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...