EIF3K (NM_013234) Human 3' UTR Clone

CAT#: SC200187

3' UTR clone of eukaryotic translation initiation factor 3 subunit K (EIF3K) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name EIF3K (NM_013234) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARG134; EIF3-p28; EIF3S12; HSPC029; M9; MSTP001; PLAC-24; PLAC24; PRO1474; PTD001
ACCN NM_013234
Insert Size 64 bp
Sequence Data
>SC200187 3’UTR clone of NM_013234
The sequence shown below is from the reference sequence of NM_013234. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGTCCAGCATCATGGCCTCCTCCCAGTAACTTCAGGTGTTTAATAAAGATGTGTTGACTCAGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_013234.4
Synonyms ARG134; EIF3-p28; EIF3S12; HSPC029; M9; MSTP001; PLAC-24; PLAC24; PRO1474; PTD001
Summary The 700-kD eukaryotic translation initiation factor-3 (eIF3) is the largest eIF and contains at least 12 subunits, including EIF2S12. eIF3 plays an essential role in translation by binding directly to the 40S ribosomal subunit and promoting formation of the 40S preinitiation complex (Mayeur et al., 2003 [PubMed 14519125]).[supplied by OMIM, Mar 2008]
Locus ID 27335
MW 2.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...