DARC (ACKR1) (NM_001122951) Human 3' UTR Clone

CAT#: SC200181

3' UTR clone of Duffy blood group chemokine receptor (DARC) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DARC (ACKR1) (NM_001122951) Human 3' UTR Clone
Vector pMirTarget
Synonyms CCBP1; CD234; DARC; DARC/ACKR1; Dfy; FY; GPD; GpFy; WBCQ1
ACCN NM_001122951
Insert Size 80 bp
Sequence Data
>SC200181 3’UTR clone of NM_001122951
The sequence shown below is from the reference sequence of NM_001122951. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CATCTGGACACCCTTGGAAGCAAATCCTAGTTCTCTTCCCACCTGTCAACCTGAATTAAAGTCTACACT
GCCTTTGTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001122951.3
Synonyms CCBP1; CD234; DARC; DARC/ACKR1; Dfy; FY; GPD; GpFy; WBCQ1
Summary The protein encoded by this gene is a glycosylated membrane protein and a non-specific receptor for several chemokines. The encoded protein is the receptor for the human malarial parasites Plasmodium vivax and Plasmodium knowlesi. Polymorphisms in this gene are the basis of the Duffy blood group system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 2532
MW 2.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...