RNA Polymerase II p14.5 (POLR2I) (NM_006233) Human 3' UTR Clone

CAT#: SC200107

3' UTR clone of polymerase (RNA) II (DNA directed) polypeptide I 14.5kDa (POLR2I) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RNA Polymerase II p14.5 (POLR2I) (NM_006233) Human 3' UTR Clone
Vector pMirTarget
Synonyms hRPB14.5; RPB9
ACCN NM_006233
Insert Size 76 bp
Sequence Data
>SC200107 3’UTR clone of NM_006233
The sequence shown below is from the reference sequence of NM_006233. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCACACTGCGGCCACCGCTGGACCGAGTGACCTCCTCTCTCCCCCGAGTGTAATAAACACCAGATTCCA
TGCGTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006233.5
Synonyms hRPB14.5; RPB9
Summary This gene encodes a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit, in combination with two other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. The product of this gene has two zinc finger motifs with conserved cysteines and the subunit does possess zinc binding activity. [provided by RefSeq, Jul 2008]
Locus ID 5438
MW 2.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...