DEFB126 (NM_030931) Human 3' UTR Clone

CAT#: SC200106

3' UTR clone of defensin beta 126 (DEFB126) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DEFB126 (NM_030931) Human 3' UTR Clone
Vector pMirTarget
Synonyms bA530N10.1; C20orf8; DEFB-26; DEFB26; hBD-26; HBD26
ACCN NM_030931
Insert Size 89 bp
Sequence Data
>SC200106 3’UTR clone of NM_030931
The sequence shown below is from the reference sequence of NM_030931. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTCCTACCCCCGTTTCTCCCACTGGTTGAACATTCCAGCCTCTGTCTCCTGCTCTAGGATCCCCGACT
CATTAAAGCAAAGAGGCTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_030931.4
Synonyms bA530N10.1; C20orf8; DEFB-26; DEFB26; hBD-26; HBD26
Summary Defensins are cysteine-rich cationic polypeptides that are important in the immunologic response to invading microorganisms. The antimicrobial protein encoded by this gene is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 20p13. The encoded protein is highly similar to an epididymal-specific secretory protein (ESP13.2) from cynomolgus monkey. Mutation of this gene is associated with impaired sperm function. [provided by RefSeq, Nov 2014]
Locus ID 81623
MW 2.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...