p38 (MAPK14) (NM_139013) Human 3' UTR Clone

CAT#: SC200072

3' UTR clone of mitogen-activated protein kinase 14 (MAPK14) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name p38 (MAPK14) (NM_139013) Human 3' UTR Clone
Vector pMirTarget
Synonyms CSBP; CSBP1; CSBP2; CSPB1; EXIP; Mxi2; p38; p38ALPHA; PRKM14; PRKM15; RK; SAPK2A
ACCN NM_139013
Insert Size 92 bp
Sequence Data
>SC200072 3’UTR clone of NM_139013
The sequence shown below is from the reference sequence of NM_139013. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCATGGATATTGAATTGGTTATGATATAAATTGGGGATTTGAAGAAGAGTTTCTCCTTTTGACCAAAT
AAAGTACCATTAGTTGAATCTTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_139013.3
Synonyms CSBP; CSBP1; CSBP2; CSPB1; EXIP; Mxi2; p38; p38ALPHA; PRKM14; PRKM15; RK; SAPK2A
Summary The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with this kinase. The substrates of this kinase include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of this kinase in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. Four alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Locus ID 1432
MW 3.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...