Apolipoprotein A I (APOA1) (NM_000039) Human 3' UTR Clone

CAT#: SC200054

3' UTR clone of apolipoprotein A-I (APOA1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Apolipoprotein A I (APOA1) (NM_000039) Human 3' UTR Clone
Vector pMirTarget
Synonyms apo(a); HPALP2
ACCN NM_000039
Insert Size 87 bp
Sequence Data
>SC200054 3’UTR clone of NM_000039
The sequence shown below is from the reference sequence of NM_000039. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGTACACTAAGAAGCTCAACACCCAGTGAGGCGCCCGCCGCCGCCCCCCTTCCCGGTGCTCAGAATAA
ACGTTTCCAAAGTGGGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000039.3
Synonyms apo(a); HPALP2
Summary This gene encodes apolipoprotein A-I, which is the major protein component of high density lipoprotein (HDL) in plasma. The encoded preproprotein is proteolytically processed to generate the mature protein, which promotes cholesterol efflux from tissues to the liver for excretion, and is a cofactor for lecithin cholesterolacyltransferase (LCAT), an enzyme responsible for the formation of most plasma cholesteryl esters. This gene is closely linked with two other apolipoprotein genes on chromosome 11. Defects in this gene are associated with HDL deficiencies, including Tangier disease, and with systemic non-neuropathic amyloidosis. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein. [provided by RefSeq, Dec 2015]
Locus ID 335
MW 3.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...