RPL6 (NM_001024662) Human 3' UTR Clone

CAT#: SC200026

3' UTR clone of ribosomal protein L6 (RPL6) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RPL6 (NM_001024662) Human 3' UTR Clone
Vector pMirTarget
Synonyms L6; SHUJUN-2; TAXREB107; TXREB1
ACCN NM_001024662
Insert Size 65 bp
Sequence Data
>SC200026 3’UTR clone of NM_001024662
The sequence shown below is from the reference sequence of NM_001024662. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGAATTTATCCTCACAAATTGGTGTTCTAAATGTCTTAAGAACCTAATTAAATAGCTGACTACAT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001024662.3
Synonyms L6; SHUJUN-2; TAXREB107; TXREB1
Summary This gene encodes a protein component of the 60S ribosomal subunit. This protein can bind specifically to domain C of the tax-responsive enhancer element of human T-cell leukemia virus type 1, and may participate in tax-mediated transactivation of transcription. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Locus ID 6128
MW 2.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...