shRNA (HuSH-29) FAQs

The pGFP-V-RS plasmid contains tGFP driven by a CMV promoter. The pRFP-C-RS plasmid contains tRFP driven by a CMV promoter. Both plasmids provide an easy way to identify cells that have been transfected. The pGFP-V-RS vector is kanamycin resistant, pRFP-C-RS vector is chloramphenicol resistant while the pRS vector is ampicillin resistant.

No. The CMV-tGFP and CMV-tRFP is outside of the region that gets packaged by retrovirus. Thus, you cannot use tGFP or tRFP expression to monitor transduction but you can use puromycin selection to generate stable cell lines.

Unless stated otherwise, shRNA constructs were designed to be effective against most transcriptional variants at a particular gene locus. If you would like a knockdown construct against a specific transcriptional variant, OriGene can generate a custom HuSH product that will selectively knockdown only the specified variants. Please review the options on our custom shRNA website at https://www.origene.com/services/custom-shrna

We recommend that you screen all constructs individually to identify the most effective constructs. HEK293 cells are a convenient and easily transfectable system for screening all human shRNA constructs (use NIH3T3 for mouse shRNA and OLN-93 for rat shRNA constructs). Other cell lines can also be used for this purpose, so long as the transfection efficiency of our pRS, pGFP-V-RS or pRFP-C-RS vector is high, ~70% or greater for transient transfections. Afterwards, the effective construct(s) can be used for retroviral infection of or for direct transfection into your target cells.

If your gene is not expressed in HEK293, you can do a co-transfection with an expression construct and the shRNA construct at a 1:1 ratio transiently into HEK293 cells. You can also select stable cells in your target cell line. It is well known that if a gene that is vital for cell growth is silenced, it will be difficult to get stable cells for that particular cell line.

Western Blot is recommended over qPCR to evaluate the silencing effect of the shRNA constructs 72 hrs post transfection. To properly assess knockdown, the gene expression level from the included scramble control vector must be used in comparison with the target-specific shRNA transfected samples.

OriGene can do any custom HuSH design and construction, regardless of species specificity. The only information you need to provide is the accession number of sequence you wish to target. We can offer you assistance in identifying the particular species' sequences to be used for gene knockdown studies or you can follow the link to our ExactHuSH page

Our pRS, pGFP-V-RS and pRFP-C-RS vectors have been designed for viral packaging in most commercially available packaging cell lines. However, please make sure that the packaging line has not been previously transfected with plasmids containing a puromycin resistance cassette. Furthermore, you need to ensure that the chosen packaging line's viral particles are able to infect your target cell line (some cell lines have restricted species specificity). We suggest packaging lines such as PT67 or Phoenix cells for use with our constructs for human and mouse cell line infection.

Customers can use the 5 ug shRNA DNA plasmid directly for transfection and gene-knockdown studies. After transfection, cell lysates can be obtained and used for Western blot analysis with an antibody against the target protein to verify the functionality of the shRNA vectors, or RNA can be harvested from transfected cells and used in quantitative RT-PCR to determine the loss of gene expression. If desired, the shRNA plasmids can be re-transformed for unlimited supplies of the plasmids.

Yes. One day after transfection, the cells can be selected with culture media containing 0.5 - 1.0 ug/mL puromycin (Sigma) for the standard catalog shRNAs.

Stable cell lines can be generated by two different methods. First, target cells can be transfected with the shRNA plasmid. One day after transfection, the transfected cells can be selected with 0.5 - 1.0 ug/ml puromycin for 1-2 weeks with passages as needed. Alternatively, retroviral packaging cell lines can be used to generate retroviruses for stable cell line generation. For example, the plasmid can be transiently transfected into the Phoenix helper-free amphotropic packaging cells line. Two days after the transfection, the cell culture supernatant is collected, filtered and used to infect the target cell lines. Stable cell lines can be established following drug selection.

For any experiment involving the introduction of foreign DNA into cells, it is important to eliminate any non-specific effects by using an empty vector negative control. The vectors can also be used for cloning your own shRNA construct(s).

To specifically rule out the potential non-specific effect induced by expression of the HuSH product, OriGene provides customers with a negative control (TR30012, TR30013, TR30015, TR30019, TR30021 or TR30033), that was constructed by cloning a scrambled sequence cassette (5' GCACTACCAGAGCTAACTCAGATAGTACT 3' ) into our pRS, pGFP-V-RS, pRFP-C-RS, pGFP-B-RS, pGFP-C-shLenti or pRFP-CB-shLenti vectors respectively. The plasmid should serve as a negative control for gene-specific knockdown experiments and exclude any potential interferon response.

The 29mer sequence used to target firefly luciferase in TR30002 is 5' GGATTTCAGTCGATGTACACGTTCGTCAC 3'. The 29mer sequence used to target eGFP in TR30001 is 5' CACAAGCTGGAGTACAACTACAACAGCCA 3', the 29mer sequence used to target tGFP in TR30009 and TR30016 is 5`GCTACGGCTTCTACCACTTCGGCACCTAC 3`, and the 29mer sequence used to target tRFP in TR30017 is 5' CTTCAAGACCACATACAGATCCAAGAAAC 3`. The non-effective control sequence is 5' GCACTACCAGAGCTAACTCAGATAGTACT 3'.

Special strain is not required for HuSH amplification but we do not recommend using JM109. We routinely use DH5alpha from New England Biolabs.

Although the plasmids technically contain a high-copy number Ori of replication, the hairpin slows replication and thus, we recommend using a low-copy number

If your transfection efficiency is very high (e.g. 80% or greater), it is not necessary to use retroviral packaging. Simply split your cells 24hrs. post-transfection and add puromycin (0.5 - 1ug/ml) to the fresh growth medium.

We strongly recommend that a kill-curve be performed on each batch of cells to ensure that the optimal puromycin concentration is employed.

HuSH 29-mer Against tGFP in pRS vector is your best choice, cat# TR30009.

It is very difficult to sequence the shRNA constructs due to the hairpin structure. However, you can use DNA relaxation agents in the sequencing reaction (0.83 M Betaine [Sigma #B-0300] plus 1x PCRx Enhancer [in Invitrogen kit part # 11495-017]), which may be helpful. Our sequencing primer is located at the 3' end of the cloning site and has the sequence 5`TTGAGATGCATGCTTTGCATAC3`.

Yes, OriGene has multiple lentiviral shRNA products. An empty vector (TR30023), a particle packaging kit (TR30022) and a negative scrambled lenti-viral control (TR30021). All pre-designed shRNA lentiviral kits have a catalog number as TLXXXXXX.
Custom shRNA orders will have the option of using OriGene’s pGFP-C-shLenti vector.

Yes, you can use any transfection method directly for your cells so long as the transfection is efficient enough for your assay. Transduction, however, usually works better.

Yes, OriGene offers a multitude of products for detection gene expression including:

• qPCR assays (primer pairs and qPCR standards)
• Monoclonal/polyclonal antibodies for protein detection

Yes, GFP can be used as a reporter for lentiviral transduction.

Yes, the puromycin resistance marker is within the lentiviral packaging cassette. You can select stable cell lines upon transfection, or more effectively, upon transduction

OriGene guarantees that the sequences in the shRNA expression cassettes are verified to correspond to the target gene with 100% identity. One of the four constructs at minimum are guaranteed to produce 70% or more gene expression knock-down provided a minimum transfection efficiency of 80% is achieved. Western Blot data is recommended over qPCR to evaluate the silencing effect of the shRNA constructs 72 hrs post transfection. To properly assess knockdown, the gene expression level from the included scramble control vector must be used in comparison with the target-specific shRNA transfected samples.

For non-conforming shRNA, requests for replacement product must be made within ninety (90) days from the date of delivery of the shRNA kit. To arrange for a free replacement with newly designed constructs, please contact Technical Services at techsupport@origene.com. Please provide your data indicating the transfection efficiency and measurement of gene expression knockdown compared to the scrambled shRNA control (Western Blot data preferred).

Here is our guideline:

Full Product Name, OriGene Technologies Inc., Rockville, MD, USA, Catalog #, Lot #.

In addition, we would love to hear from you when the paper is published. Email us a copy of the accepted manuscript and receive a special gift.