TrueORF Clones/PrecisionShuttle FAQs

The PrecisionShuttle System provides a restriction-enzyme-based approach to append different tags to one's open reading frame (ORF) of interest.

The major differences are the antibiotic selection marker and the epitope tags. The Entry vector carries kanamycin resistance (25 ug/ml), while all destination vectors contain the ampicillin resistance gene (100 ug/ml). This allows simple screening for successful subcloning products. All of the vectors have a unique combination of N- and C-terminal epitope tags or a fluorescent marker.

Like all OriGene vectors, the CMV promoter drives the heterologous expression of the specified open reading frame (ORF) which is in-frame with Turbo Green Fluorescent Protein (tGFP) on the C-terminus. tGFP expression permits the positive identification of mammalian cells transfected with plasmid. The neomycin resistance gene is also expressed downstream of the SV40 promoter within the same vector and permits positive selection of transfected cells as well as stable cell line production. For bacterial amplification, the ampicillin resistance gene is engineered on the opposite strand.

TurboGFP is a fully licensed, 26kDA protein product from Evrogen JSC 17 that works well in standardized GFP assays. Excitation max is 482nm and emission max is 502nm. It yields 112% of the brightness compared to eGFP and has no known cellular toxicity. It is an isoform of the naturally occurring protein from Pontellina plumata that has been optimized for rapid labeling of cells/organelles and tracking of promoter activity. It is a perfect choice for monitoring transient protein expression.

95% of the TrueORF clones have been fully sequenced and the sequencing data are posted on the product page. For the 5% not fully sequenced, the ORF insert was PCR amplified using fully sequenced plasmids as templates and Phusion High-Fidelity DNA Polymerase (New England Biolabs), which has a mutation rate less than 4 x 10^7. This ensures the highest fidelity of every TrueORF clone. After cloning into the Entry vector, each of OriGene’s TrueORF clones was sequenced at both the 5’ and 3’ ends, and the resulting sequence was matched to the corresponding reference sequence. For ORFs of 1 Kb or less in length, the 5’ and 3’ sequencing reads have covered the full ORF.

All TrueORF clones are guaranteed to match the corresponding ORF sequence posted on our website. However, some clones may contain nucleotide changes compared to the published reference sequences. This is due to SNPs (single nucleotide polymorphisms) reflecting the unique differences from genes expressed in different tissues and different individuals. Published references may represent a different SNP than the OriGene transcript. Should a specific SNP be required, this can be obtained via our Gene Synthesis service.

VP1.5 (forward seq primer)
5’ GGACTTTCCAAAATGTCG 3’ Tm=51C

XL39 (reverse seq primer)
5’ ATTAGGACAAGGCTGGTGGG 3’ Tm=60C

EF50 (forward seq primer for lenti-EF1a vectors)
5’ CTTCCATTTCAGGTGTCGTGAC 3’  TM: 55C

V2 (forward seq primer for lenti-CMV vectors)
5’ AGAGCTCGTTTAGTGAA  3’ TM: 42C

LR50 (reverse seq primer for lenti-ORF vectors)
5’ CAGAGGTTGATTATCGATAAG 3’ TM: 48.5C

It has been reported that ORFs larger than 4 Kb are unstable in recombination-based systems; conversely, our restriction digest-based vector system has no real size limitation. An ORF up to 18 Kb can be readily transferred from one vector to another.

While 96% of all human and mouse ORFs can use the Sgf I - Mlu I combination, some ORFs do contain internal Mlu I site(s). Most of those ORFs with an internal Mlu I site can be transferred using another rare cutter (Rsr II), whose restriction site is upstream of Mlu I, or Not I, whose site is immediately downstream of Mlu I. Using one of the four different subcloning combinations, any ORF can be transferred from one vector to another. The recommended subcloning combination for every TrueORF cDNA is listed in the product information on our website.

Whenever one or both of these sites is present within the ORF of the transcript, the PrecisionShuttle vectors share other sites engineered to accommodate this, e.g. Rsr II or Asc I.

There are multiple sites in pCMV6-Entry than can be used to move the insert of a TrueORF clone into one of Gateway's Entry vectors (pENTR-1A, -2B, -3C, -4, and -11). These sites are EcoRI, Sal I, BamHI and Kpn I at the 5' end, and Not I at the 3' end.

The vector maps and nucleotide sequences can be found at http://www.origene.com/cdna/trueorf/destinationvector.aspx

To accommodate the Mlu I cloning site, which maintains the proper reading frame, this vector appends a threonine and arginine. This is far fewer than with other recombination-based shuttling systems.

We recommend pCMV6-AN-GFP (Cat# PS100019).

Yes, The catalog number is PS100001 for a lyophilized 10 ug aliquot. Alternatively, you can release the ORF from the Entry vector with Xho I and Sal I, and then religate to create the empty Entry vector control.

1) Check your transfection efficiency. We recommend using a plasmid that expresses a fluorescent marker (pCMV6-AN-GFP PS100019). 2) Anti-FLAG antibodies from other vendors are not as sensitive as OriGene’s optimized 4C5-Anti-DDK antibody (TA50011) when directed at the same epitope. In addition, the expression level of the C-terminal tagged fusion protein depends on the nature of the target protein, such as mRNA stability, translation efficiency and protein stability.

OriGene's disclaimer for the TrueORF clones reads as follows: ?Our molecular clone sequence data has been matched to the accession number below as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding accession number, e.g., by representing an alternative RNA splicing form or single nucleotide polymor-phism (SNP).? The NCBI RefSeq mRNA sequences are continuously being revised, as some may have been derived from aberrantly spliced transcripts or generated by incorrect prediction of intron-exon junctions in silico. These sequences are therefore used only as a "reference" and not as a "standard". OriGene's clones are isolated from full-length cDNA libraries and may differ from the reference sequence for this reason.

We have heard that there can be lot-to-lot variations of the commercially available SgfI enzyme. Several of our scientists have begun to use the "FastDigest? AsiSI (SfaAI) " enzyme (Fermentas) that has the same recognition sequence. In our hands the double digestions with MluI are complete in a shorter time using this enzyme compared to some but not all SgfI batches.

Your protein of interest might quench the fluorescence of tGFP. To confirm, we suggest you first run a Western Blot with a protein specific antibody or anti-tGFP. The molecular weight of the tGFP fusion protein is approximately 26 kDa larger than the endogenous protein. We recommend OriGene’s Anti-tGFP antibody (part number TA50041). Antibodies against other GFPs will not recognize tGFP

Over 100 destination vectors are designed with compatible MCS for easy shuttling of TrueORF inserts. This can be performed easily using a specific pair of restriction enzymes to cut-and-ligate subclone into the desired destination vector. OriGene also provides a custom cloning service available through our website.

No. Every gene expression is different. Because the cDNA is driven by a strong promoter, mRNA can be expressed. However, a few factors can affect the steady state level of the protein of interest, including mRNA stability, protein translation efficiency and protein stability. Therefore, gene expression can not be guaranteed. This is the nature of genes. The sequence of a cDNA clone can be guaranteed to match the sequence posted on the website.

OriGene warrants that the product will meet specifications listed. At OriGene's discretion, free replacement of any non-conforming product will be made if OriGene is notified within 30 days of product receipt. If you experience any difficulty with any OriGene product, please contact our Technical Support Staff at 888-267-4436, or 301-340-3188 outside the US.

Here is our guideline:

Full Product Name, OriGene Technologies Inc., Rockville, MD, USA, Catalog #, Lot #.

In addition, we would love to hear from you when the paper is published. Email us a copy of the accepted manuscript and receive a special gift.